NLRP6 (72 of 83)

Ensembl ID:
ENSDARG00000068621
Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9601 Nonsense Available for shipment Available now
sa8657 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099313 Nonsense 310 966 4 8
ENSDART00000099313 Nonsense 310 966 4 8
Genomic Location (Zv9):
Chromosome 15 (position 41281577)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42796743
KASP Assay ID:
2260-8972.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATTCAAAACTCWGCTGTCATCTTCATCTTTGATGGACTGGATGAGTG[T/A]CGTCTTCCTTTCAACTTTAGCCGCAATGAGATCCTATTGGATGTRACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099313 Nonsense 310 966 4 8
ENSDART00000099313 Nonsense 310 966 4 8
Genomic Location (Zv9):
Chromosome 15 (position 41281577)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42796743
KASP Assay ID:
2260-8972.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATTCAAAACTCWGCTGTCATCTTCATCTTTGATGGACTGGATGAGTG[T/A]CGTCTTCCTTTCAACTTTAGCCGCAATGAGATCCTATTGGATGTRACCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link