PLCB1 (2 of 2)

Ensembl ID:
ENSDARG00000068594
Description:
phospholipase C, beta 1 (phosphoinositide-specific) [Source:HGNC Symbol;Acc:15917]
Human Orthologue:
PLCB1
Human Description:
phospholipase C, beta 1 (phosphoinositide-specific) [Source:HGNC Symbol;Acc:15917]
Mouse Orthologue:
Plcb1
Mouse Description:
phospholipase C, beta 1 Gene [Source:MGI Symbol;Acc:MGI:97613]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37190 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43555 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099268 Essential Splice Site 67 403 2 11
Genomic Location (Zv9):
Chromosome 20 (position 55146771)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54999643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACCTGCTGGCCCAGAACCTGTCCAGAGAGTCCAGTCTGGAGAAAGTG[T/A]AAGTGTCCCGTTTCCTCCTCTGTTTTCACCCCACACACACTCTCAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099268 Nonsense 247 403 7 11
Genomic Location (Zv9):
Chromosome 20 (position 55139556)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54992428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACACAGCCGCTCTCACACTACTTCATCAACTCTTCACACAACACCTA[C/A]CTCATAGGTCAGCCAATCACACAACACCTGCCTCATAGGTCAGCCAATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link