A5PL78_DANRE

Ensembl ID:
ENSDARG00000068589
Description:
LOC572200 protein [Source:UniProtKB/TrEMBL;Acc:A5PL78]
Human Orthologues:
NES, SYNM
Human Descriptions:
nestin [Source:HGNC Symbol;Acc:7756]
synemin, intermediate filament protein [Source:HGNC Symbol;Acc:24466]
Mouse Orthologues:
Nes, Synm
Mouse Descriptions:
nestin Gene [Source:MGI Symbol;Acc:MGI:101784]
synemin, intermediate filament protein Gene [Source:MGI Symbol;Acc:MGI:2661187]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16011 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099252 Essential Splice Site 126 240 1 3
Genomic Location:
Chromosome 21 (position 484760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACCAGATGAAGAGCAAGAAGGACGAGATCCTGACCTTCCACAAYCAG[G/A]TGAGCAACCTGAACCACAGATTAATAACTCGCTTTTTAACWCATGAGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ggr4w4pg