rabggtb

Ensembl ID:
ENSDARG00000068587
ZFIN ID:
ZDB-GENE-040426-2116
Description:
geranylgeranyl transferase type-2 subunit beta [Source:RefSeq peptide;Acc:NP_998277]
Human Orthologue:
RABGGTB
Human Description:
Rab geranylgeranyltransferase, beta subunit [Source:HGNC Symbol;Acc:9796]
Mouse Orthologue:
Rabggtb
Mouse Description:
RAB geranylgeranyl transferase, b subunit Gene [Source:MGI Symbol;Acc:MGI:99537]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19768 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099247 Essential Splice Site 1 165 None 5
ENSDART00000099248 Essential Splice Site 1 331 None 9
ENSDART00000134495 None None 172 None 6
Genomic Location:
Chromosome 2 (position 26617174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCTGAAGTCAGCCTGTAGTCCGGTCTCTTGTTTCTCCTGCAGAATGG[T/G]ACGTAAACACAATACTGTTTTGTAAACGTTTAATTGTTTAATTAATAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3l3q331j