CDHR2 (1 of 2)

Ensembl ID:
ENSDARG00000068586
Description:
cadherin-related family member 2 [Source:HGNC Symbol;Acc:18231]
Human Orthologues:
CDH23, CDHR2
Human Descriptions:
cadherin-related 23 [Source:HGNC Symbol;Acc:13733]
cadherin-related family member 2 [Source:HGNC Symbol;Acc:18231]
Mouse Orthologue:
Cdhr2
Mouse Description:
cadherin-related family member 2 Gene [Source:MGI Symbol;Acc:MGI:2687323]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39013 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099244 Essential Splice Site 108 1102 5 25
Genomic Location (Zv9):
Chromosome 14 (position 47835680)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 45725790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTATTATTTTTAATTAATATTATGTTCATTATCATTCTCTCTCCTTC[A/T]GAACACTACTGTGGGCTTCGTACTGTTCACAGCAAGTGCCACAGACAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Vitiligo: Association analyses identify three susceptibility Loci for vitiligo in the Chinese Han population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link