rnf44

Ensembl ID:
ENSDARG00000068582
ZFIN ID:
ZDB-GENE-060929-604
Description:
RING finger protein 44 [Source:UniProtKB/Swiss-Prot;Acc:Q08CG8]
Human Orthologue:
RNF44
Human Description:
ring finger protein 44 [Source:HGNC Symbol;Acc:19180]
Mouse Orthologue:
Rnf44
Mouse Description:
ring finger protein 44 Gene [Source:MGI Symbol;Acc:MGI:2145310]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18224 Essential Splice Site Available for shipment Available now
sa42444 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099235 Essential Splice Site 232 448 5 11
ENSDART00000146134   None 83 None 3

The following transcripts of ENSDARG00000068582 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 47759135)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGCCGATCAACCAGTTCGTCCCCATTCAGCCGCAGCACCCGCGCATGG[T/C]GAGTAACACTCMGGCAACACAAACTACCATAAATCATACCYGTCAACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099235 Nonsense 299 448 7 11
ENSDART00000146134   None 83 None 3

The following transcripts of ENSDARG00000068582 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 47748501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGTTTCCTCAGCCATATCCACACATGCTGCCGAGGCGTATAACGGGA[C/T]AGAGGTATCGGTTACAGCAGCCTCTGCCTCCGCCGCCGCCTCCACCGCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link