si:ch211-106k21.6

Ensembl ID:
ENSDARG00000068580
ZFIN ID:
ZDB-GENE-070912-8
Human Orthologue:
GLIS1
Human Description:
GLIS family zinc finger 1 [Source:HGNC Symbol;Acc:29525]
Mouse Orthologue:
Glis1
Mouse Description:
GLIS family zinc finger 1 Gene [Source:MGI Symbol;Acc:MGI:2386723]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19771 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19771
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099228 Nonsense 87 288 1 3
Genomic Location (Zv9):
Chromosome 2 (position 26711888)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26908084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATCTTTGTAGCAAGAAGCTTCTAGACAAGGAAGAACTTTTCCAGTA[T/A]CGCAGCAGTGACTGCAAGGAGCATCTTAACTTTCACCATTTTCAGACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link