olfcd3

Ensembl ID:
ENSDARG00000068576
ZFIN ID:
ZDB-GENE-050712-4
Description:
Odorant receptor VR3.13a [Source:UniProtKB/TrEMBL;Acc:Q4VDB2]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18045 Nonsense Available for shipment Available now
sa25067 Nonsense Mutation detected in F1 DNA During 2014
sa10065 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059500 Nonsense 183 850 3 6
ENSDART00000099111 Nonsense 102 539 2 7
Genomic Location:
Chromosome 18 (position 31321423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATCAGTCAYTTTGCCACATGTGYCTGCTTGAGTAACAGAAAAAGGTA[T/G]GCATCCTTCTTTAGAACGATCCCCAGTGACTATTACCAAAGCAGAGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059500 Nonsense 289 850 3 6
ENSDART00000099111 None None 539 None 7
Genomic Location:
Chromosome 18 (position 31321107)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTGTTGCATTAAGAGATTTTTACCCACTTTTAAAAGAAATTGCGCAA[C/T]AAAACATTACAGGGCTGCAGTGGGTTGGCAGTGAATCTTGGATAACATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059500 Nonsense 725 850 6 6
ENSDART00000099111 None None 539 None 7
Genomic Location:
Chromosome 18 (position 31319408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTTKGTTAACTGTCTCTCCTCCATTCCCATATAAGAATTTGAGCTA[T/A]TACAGAGAAAAGATCATCCTGGAATGTAATTTRGGTTCAGCTTTGGGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y2q4mflk