Q1MTB6_DANRE

Ensembl ID:
ENSDARG00000068562
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MTB6]
Human Orthologue:
RBM33
Human Description:
RNA binding motif protein 33 [Source:HGNC Symbol;Acc:27223]
Mouse Orthologue:
Rbm33
Mouse Description:
RNA binding motif protein 33 Gene [Source:MGI Symbol;Acc:MGI:1919670]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34143 Nonsense Mutation detected in F1 DNA During 2017
sa21042 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084070 Nonsense 1001 1180 15 19
Genomic Location (Zv9):
Chromosome 7 (position 43656808)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40647108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGGCATGGCCTGGGTCAGCCTCAGCCCGGTGGAAAAAGAACAGTGATG[C/T]AAAGAACCAACAGTGTTGAATCACCACAAGTTCCACAGAAAGTGCGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084070 Nonsense 1037 1180 16 19
Genomic Location (Zv9):
Chromosome 7 (position 43650523)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40640823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTTCAGCAGGCAGATGCCAGTCCCAGCACTGCTCCCTCACAGCAA[C/T]AGCAACCACCAATTGGTCGGCCTATCCCCCAACAGAGGCTTGGTCCCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link