hapln1b

Ensembl ID:
ENSDARG00000068516
ZFIN ID:
ZDB-GENE-050920-1
Human Orthologue:
HAPLN1
Human Description:
hyaluronan and proteoglycan link protein 1 [Source:HGNC Symbol;Acc:2380]
Mouse Orthologue:
Hapln1
Mouse Description:
hyaluronan and proteoglycan link protein 1 Gene [Source:MGI Symbol;Acc:MGI:1337006]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4394 Nonsense Mutation detected in F1 DNA During 2014
sa5834 Nonsense Mutation detected in F1 DNA During 2014
sa21814 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062631 Nonsense 47 353 2 4
ENSDART00000142526 Nonsense 47 352 3 5
ENSDART00000146660 None None 40 None 3
Genomic Location:
Chromosome 10 (position 44761363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTATTGGGNTTTTTAGAAAACGGCCCCCGACTCTCAGTCGACACAGCA[C/T]AACCCAAAGTGATCTCTCAGCGCGGAGGCAAYGCCACACTGCCATGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062631 Nonsense 104 353 2 4
ENSDART00000142526 Nonsense 104 352 3 5
ENSDART00000146660 None None 40 None 3
Genomic Location:
Chromosome 10 (position 44761190)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAGGAAAYTGAWGTGTTTGTGGCGATGGGCTTCCACAAAAAGAGCTA[C/A]GGTCGATTCCACGGCCGCGTTCACCTTCAGGCTGCCAGCGAGAGCGACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062631 Nonsense 233 353 3 4
ENSDART00000142526 Nonsense 233 352 4 5
ENSDART00000146660 None None 40 None 3
Genomic Location:
Chromosome 10 (position 44756067)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCATCACCAAACCCAGAGAGCCATGTGGAGGCAAAAACACCATTCCC[G/T]GAGTCAGGAACTATGGGATACGAGACAAGCAAAAAGAACAATACGATGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ankylosing spondylitis: A genome-wide association study in Han Chinese identifies new susceptibility loci for ankylosing spondylitis. (View Study)
  • Prostate cancer: A genome-wide association study of breast and prostate cancer in the NHLBI's Framingham Heart Study. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/flvu2pry