gbgt1l4

Ensembl ID:
ENSDARG00000068503
ZFIN ID:
ZDB-GENE-031204-4
Description:
globoside alpha-1,3-N-acetylgalactosaminyltransferase 1, like 4 [Source:RefSeq peptide;Acc:NP_95641
Mouse Orthologue:
Abo
Mouse Description:
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33588 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099083 Nonsense 201 349 7 8
ENSDART00000099084 Nonsense 201 349 7 7
ENSDART00000133805 Nonsense 195 285 7 7
ENSDART00000134184 Nonsense 194 342 7 7

The following transcripts of ENSDARG00000068503 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 25458488)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23285753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGGCTGGAGAAACTAATTGAGAGTCGATTGGTGAAGGAAGCTGACTA[T/A]GTTTTCAGCCTTGACGTTGATACAAAGTTCTACGCCCGCTGGGGTGCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link