LOC100000156

Ensembl ID:
ENSDARG00000068493
Human Orthologues:
CYP2F1, CYP2S1
Human Descriptions:
cytochrome P450, family 2, subfamily F, polypeptide 1 [Source:HGNC Symbol;Acc:2632]
cytochrome P450, family 2, subfamily S, polypeptide 1 [Source:HGNC Symbol;Acc:15654]
Mouse Orthologues:
Cyp2f2, Cyp2s1, Cyp2t4
Mouse Descriptions:
cytochrome P450, family 2, subfamily f, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:88608]
cytochrome P450, family 2, subfamily s, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1921384]
cytochrome P450, family 2, subfamily t, polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:2686296]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22559 Nonsense Available for shipment Available now
sa10284 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099074 Nonsense 215 491 4 9
Genomic Location:
Chromosome 15 (position 57727)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCCAGATCATCTCTAACCTCATGCGATTTGCAAGCAGCCCTTGGGGA[C/T]AGGTGAGCCACTGAGACAGTGTGGGGCAGGTTTGAGAATGAAGAATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099074 Nonsense 250 491 5 9
Genomic Location:
Chromosome 15 (position 56896)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATKTTWGGAGAGATTGATGATCTCAAATCCTCYATAATGAYAATTATC[A/T]AGGAGCATGAGGAGAATTTGGATYCCAGTGACCCAAAGGACTTTATTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mzj7c2ie