ENSDARG00000068484

Ensembl ID:
ENSDARG00000068484
Human Orthologue:
ATL2
Human Description:
atlastin GTPase 2 [Source:HGNC Symbol;Acc:24047]
Mouse Orthologue:
Atl2
Mouse Description:
atlastin GTPase 2 Gene [Source:MGI Symbol;Acc:MGI:1929492]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41922 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085222 Nonsense 52 347 2 14
Genomic Location (Zv9):
Chromosome 11 (position 46365842)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 44189379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAATCAGCACGAGGAGCTGCAGAGCGTCAGGAAACACATCCACTCCTG[C/A]TTCTCCAGCATCAGCTGCTTCCTGCTGCCGCACCCGGGGCTCAGAGTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link