neto1

Ensembl ID:
ENSDARG00000068483
ZFIN ID:
ZDB-GENE-070912-592
Human Orthologue:
NETO1
Human Description:
neuropilin (NRP) and tolloid (TLL)-like 1 [Source:HGNC Symbol;Acc:13823]
Mouse Orthologue:
Neto1
Mouse Description:
neuropilin (NRP) and tolloid (TLL)-like 1 Gene [Source:MGI Symbol;Acc:MGI:2180216]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39847 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092356 Nonsense 367 523 9 9
Genomic Location (Zv9):
Chromosome 2 (position 30191307)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30492942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTGACCTGCGGAGTGGTCCTCATCCTGCTCACCGTGTCCATAATCATT[C/T]AGATAAAACAGCCACGCAAGAGGTACATCATCCGTAGGGACGAATTCGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link