map7d2a

Ensembl ID:
ENSDARG00000068480
ZFIN ID:
ZDB-GENE-060526-150
Description:
MAP7 domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001093562]
Human Orthologue:
MAP7D2
Human Description:
MAP7 domain containing 2 [Source:HGNC Symbol;Acc:25899]
Mouse Orthologue:
Mtap7d2
Mouse Description:
MAP7 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917474]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1544 Nonsense F2 line generated During 2014
sa2265 Nonsense Mutation detected in F1 DNA During 2014
sa5741 Nonsense F2 line generated During 2014
sa1362 Nonsense Available for shipment Available now
sa15535 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1544
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085969 Nonsense 20 715 2 16
Genomic Location:
Chromosome 5 (position 25662985)
KASP Assay ID:
554-1487.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WTCCCACTCTCTTTTTTTTNNNNACAGCAGCTACTAACGCAATGACCTCACCTT[T/G]AACTCCTGAAAAGAGGCCTCAGAGTAATGGTCACGCCTCACCAACTTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085969 Nonsense 267 715 9 16
ENSDART00000085969 Nonsense 267 715 9 16
Genomic Location:
Chromosome 5 (position 25643623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAGAGCATTATGCATTATTTGTGTTTGCTGCAGAAGGAGAGACTGCGC[A/T]GAGAGAGGAGGACTGGCTCACCGGCCACAGGTTCACCAATCAGACGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5741
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085969 Nonsense 267 715 9 16
ENSDART00000085969 Nonsense 267 715 9 16
Genomic Location:
Chromosome 5 (position 25643623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAGAGCATTATGCATTATTTGTGTTTGCTGCAGAAGGAGAGACTGCGC[A/T]GAGAGAGGAGGACTGGCTCACCGGCCACAGGTTCACCAATCAGACGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085969 Nonsense 549 715 13 16
Genomic Location:
Chromosome 5 (position 25637948)
KASP Assay ID:
554-1274.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGGAGAGAGAGCTTTCCAAGCAGCAGGAGGAACAGGAGAGACAACAA[C/T]GAAAAAAGGTACGGCCAGCAGCAATACAATGTAATCAACATTGCAAAGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085969 Nonsense 715 715 16 16
Genomic Location:
Chromosome 5 (position 25630103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTAAACTCCTCTCCTCCAATTCTCCAGCCTCTGACAAACACCATGTA[C/T]AATAAGGTAAAWGACTCCTCGACTGCTGAAAGGAAATTGTRTCTTTGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/840ik6nx