gpx4a

Ensembl ID:
ENSDARG00000068478
ZFIN ID:
ZDB-GENE-030410-2
Description:
glutathione peroxidase 4 [Source:RefSeq peptide;Acc:NP_001007283]
Human Orthologue:
GPX4
Human Description:
glutathione peroxidase 4 (phospholipid hydroperoxidase) [Source:HGNC Symbol;Acc:4556]
Mouse Orthologue:
Gpx4
Mouse Description:
glutathione peroxidase 4 Gene [Source:MGI Symbol;Acc:MGI:104767]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9384 Nonsense Mutation detected in F1 DNA During 2017
sa8646 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099056 Nonsense 10 112 3 7
ENSDART00000144031 Nonsense 10 112 3 7
ENSDART00000147423 Nonsense 10 112 4 8

The following transcripts of ENSDARG00000068478 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17816371)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17567306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTACTCTCAGTTTGCAGAGATGCACGCCAAGTACTCTGAGAGAGGTT[T/A]ACGCATCCTGGCTTTCCCTTCCAACCAGTTCGGACRTCAGGTATGGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099056 Nonsense 111 112 7 7
ENSDART00000144031 Nonsense 111 112 7 7
ENSDART00000147423 Nonsense 111 112 8 8

The following transcripts of ENSDARG00000068478 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17813964)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17564899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGTCTYTAAATATAATTTCAGGTGGTGGAGAAGGATCTTTCTAAATA[T/A]CTCTAATGTGCTGGATGAGCTGAACTAGCGTCTGAGCGCTGGGTGTGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link