si:dkey-161j23.4

Ensembl ID:
ENSDARG00000068468
ZFIN ID:
ZDB-GENE-091112-7
Human Orthologue:
DNAH3
Human Description:
dynein, axonemal, heavy chain 3 [Source:HGNC Symbol;Acc:2949]
Mouse Orthologue:
Dnahc3
Mouse Description:
dynein, axonemal, heavy chain 3 Gene [Source:MGI Symbol;Acc:MGI:2683040]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44192 Nonsense Mutation detected in F1 DNA During 2017
sa31104 Nonsense Mutation detected in F1 DNA During 2017
sa44193 Nonsense Mutation detected in F1 DNA During 2017
sa24559 Nonsense Available for shipment Available now
sa37960 Nonsense Mutation detected in F1 DNA During 2017
sa44194 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8865 Nonsense Mutation detected in F1 DNA During 2017
sa45015 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 1357 3868 29 59
ENSDART00000142998 Nonsense 146 2661 4 32
ENSDART00000099041 Nonsense 1357 3868 29 59
ENSDART00000142998 Nonsense 146 2661 4 32
Genomic Location (Zv9):
Chromosome 24 (position 41041111)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39580305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGCTCAGAAGATTGTGGCAACGTATCGTCTGTGTTCAGAGCAGCTCT[C/A]GTCTCAACCGCACTACGATTATGGGATGCGTGCGGTGAAATCCGTCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 1357 3868 29 59
ENSDART00000142998 Nonsense 146 2661 4 32
ENSDART00000099041 Nonsense 1357 3868 29 59
ENSDART00000142998 Nonsense 146 2661 4 32
Genomic Location (Zv9):
Chromosome 24 (position 41041111)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39580305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGCTCAGAAGATTGTGGCAACGTATCGTCTGTGTTCAGAGCAGCTCT[C/A]GTCTCAACCGCACTACGATTATGGGATGCGTGCGGTGAAATCCGTCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 1364 3868 29 59
ENSDART00000142998 Nonsense 153 2661 4 32
Genomic Location (Zv9):
Chromosome 24 (position 41041133)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39580327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTATCGTCTGTGTTCAGAGCAGCTCTCGTCTCAACCGCACTACGATTA[T/A]GGGATGCGTGCGGTGAAATCCGTCCTGACTGCCGCAGGAAACCTGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 1542 3868 32 59
ENSDART00000142998 Nonsense 331 2661 7 32
Genomic Location (Zv9):
Chromosome 24 (position 41044440)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39583634
KASP Assay ID:
2261-9083.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGAGTCACGAGTGGTCAGATGGTGTTTTGGCCACTTCATTCAGACAG[C/T]AGGCCCAGTGCACCAATGACGACCGCCAGTGGATCATCTTCGACGGGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 2477 3868 47 59
ENSDART00000142998 Nonsense 1257 2661 21 32
Genomic Location (Zv9):
Chromosome 24 (position 41062210)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39601404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGCAGGAGCTCACAGCTCTACAGCCAGAACTTATCGAGACCGCGAAA[C/T]AGACTGATCAGATGATGGTGAAGATAGAAAAAGAGACAGTGGAGGTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Essential Splice Site 2517 3868 47 59
ENSDART00000142998 Essential Splice Site 1297 2661 21 32
Genomic Location (Zv9):
Chromosome 24 (position 41062333)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39601527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGATGAGAAAGTGGCCAATGAAGCAGCAGCTGCTGCTAAAGCGATCAAG[G/T]TAATCAGGTGGAACTGCTTTGACACTTGCATTTGCAAACTTATTTAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 2712 3868 49 59
ENSDART00000142998 Nonsense 1492 2661 23 32
Genomic Location (Zv9):
Chromosome 24 (position 41065536)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39604730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTRGAGGACCGTCTGCAGGCACTCAATGACACATTCRAARGGATGATA[C/T]AGAAGAAGAAAGACCTAGAGGCAAACATCGAGCTCTGTTCGCARAAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099041 Nonsense 3684 3868 57 59
ENSDART00000142998 Nonsense 2477 2661 30 32
Genomic Location (Zv9):
Chromosome 24 (position 41080336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGTCTTCTTGTTGGTAAAGTGCCAGCCATGTGGGCTGCAAAGTCCTA[C/A]CCTTCCCTCAAACCCCTCGGCAGCTACGTGTCCGACTTCCTGGCCAGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link