OTOG

Ensembl ID:
ENSDARG00000068460
Description:
otogelin [Source:HGNC Symbol;Acc:8516]
Human Orthologue:
OTOG
Human Description:
otogelin [Source:HGNC Symbol;Acc:8516]
Mouse Orthologue:
Otog
Mouse Description:
otogelin Gene [Source:MGI Symbol;Acc:MGI:1202064]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16704 Nonsense Available for shipment Available now
sa21034 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10228 Nonsense Available for shipment Available now
sa18441 Essential Splice Site Available for shipment Available now
sa21033 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18470 Essential Splice Site Available for shipment Available now
sa17990 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083804 Nonsense 110 2794 4 55
Genomic Location:
Chromosome 7 (position 40919957)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTCGTTCAATCAGCCTCTTCCTGCCATGGGAGGGCGAGATTAGGTTA[C/T]AGCACTTCAGTGTTACTTTCAAGGGTCAAAGGTAATGAACATTGACAMTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083804 Essential Splice Site 851 2794 21 55
Genomic Location:
Chromosome 7 (position 40886257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGAATATTATCCAGGAGACAAAGTATCTTCCCCATGTCATCAGTGG[T/A]GAGATTATGTTCACTTACATTCAGGTCTTCACACAGAGCTTTAGGAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083804 Nonsense 956 2794 24 55
Genomic Location:
Chromosome 7 (position 40882860)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTGCAGAAYCCATCCAGTGTGATTGACAGGCAGAGAGYATATATCTG[G/A]CAGGCAGGATATTACACCATTGTACATCTGCTTGGGGAAGACCTCACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083804 Essential Splice Site 1069 2794 26 55
Genomic Location:
Chromosome 7 (position 40880308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTGTGGGATTTTGCKCAGTGAAGTRTTTCMAGTCTGCCACCCTGTGG[T/A]AAGTCGATCACCTCTGAGTGGTTATCATTCCCACTGAGAGAAAATGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083804 Essential Splice Site 1070 2794 27 55
Genomic Location:
Chromosome 7 (position 40880209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTGAGTGAGAAAGGGTCTCTGTGTTTAAAAGTGTTTGATGCTCTGTA[G/T]GTAGATGTCACATGGTTCTACATGAACTGCTTGGTGGACACATGTGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083804 Essential Splice Site 1701 2794 34 55
Genomic Location:
Chromosome 7 (position 40875009)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCACTTCTGAGAAACCTCTGCTAACATCTACTGCAGCTGAAGAGGAG[G/A]TTGTTTCCACCACTCAAACAWCCACAACTACACATTTGACAATACAKCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083804 Essential Splice Site 1702 2794 35 55
Genomic Location:
Chromosome 7 (position 40874813)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTACCATTCCTTCCACAATGGCTCCAAGACYTACAACTCGTATCACAC[C/T]GGTCTTAACCTCACGGGTAGGTGTAGATAYCATTCGACAGACTCCACAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vh2sebnr