tnnt3b

Ensembl ID:
ENSDARG00000068457
ZFIN ID:
ZDB-GENE-030520-2
Description:
troponin T3b, skeletal, fast isoform 2 [Source:RefSeq peptide;Acc:NP_857636]
Human Orthologue:
TNNT3
Human Description:
troponin T type 3 (skeletal, fast) [Source:HGNC Symbol;Acc:11950]
Mouse Orthologue:
Tnnt3
Mouse Description:
troponin T3, skeletal, fast Gene [Source:MGI Symbol;Acc:MGI:109550]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21032 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033610 None None 284 None 11
ENSDART00000099013 None None 282 None 11
ENSDART00000099015 None None 228 None 10
ENSDART00000103056 None None 228 None 11
ENSDART00000123171 Essential Splice Site 76 294 5 13
ENSDART00000123855 Essential Splice Site 20 245 4 13
ENSDART00000125723 None None 232 None 10
ENSDART00000130570 None None 226 None 10
ENSDART00000138192 Essential Splice Site 20 245 5 14
ENSDART00000141750 None None 232 None 12
ENSDART00000142946 None None 284 None 12
ENSDART00000143999 Essential Splice Site 76 245 6 12
ENSDART00000144075 None None 232 None 10
ENSDART00000145457 Essential Splice Site 20 220 5 12

The following transcripts of ENSDARG00000068457 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 40843711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTCTTGCTTTCAACGCTTGATGCATGCAGAGGCCTATGAAGAGGAAG[G/A]TATGTTTGTCATTTCCTTTTATTTGTTGATTTTTGATTAGAAAAAAGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t4lwu52y