si:ch211-195h23.3

Ensembl ID:
ENSDARG00000068431
ZFIN ID:
ZDB-GENE-070912-174
Description:
si:ch211-195h23.3 [Source:RefSeq peptide;Acc:NP_001123874]
Human Orthologue:
CARD8
Human Description:
caspase recruitment domain family, member 8 [Source:HGNC Symbol;Acc:17057]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31297 Essential Splice Site Available for shipment Available now
sa38353 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa19856 Nonsense Available for shipment Available now
sa19857 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108591 Essential Splice Site 83 478 5 13
ENSDART00000123673 Essential Splice Site 83 478 5 13
Genomic Location (Zv9):
Chromosome 2 (position 44006429)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44091930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTTACAGGCTTCCAAAAAAACTGAAACTGTTTTGGAGCATGTGGATG[G/A]TGAGTAAACATGGTATAATTTTTATTTTAAATGTAATAATAAATGTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108591 Splice Site, Nonsense 117 478 7 13
ENSDART00000123673 Splice Site, Nonsense 117 478 7 13
Genomic Location (Zv9):
Chromosome 2 (position 44007118)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44092619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCTGAACTTATTCAAGAAGATGACAAGTACAAAGACAAGAATACATA[C/A]AGGTATTGAACAGTTGTGTTCTTTGGAATCTGTAAAAAGATAATGTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108591 Nonsense 365 478 11 13
ENSDART00000123673 Nonsense 365 478 11 13
Genomic Location (Zv9):
Chromosome 2 (position 44013454)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44098955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTATTTTAGACAAAGCTGAAGATTGTAAGGAAGTGTGGAGCCGACCA[C/T]GAGTATCACTTAAAGGTAAAAAACATTTGGTTGTTCAAACTTTGTGTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19857
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108591 Nonsense 436 478 13 13
ENSDART00000123673 Nonsense 436 478 13 13
Genomic Location (Zv9):
Chromosome 2 (position 44016483)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44101984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATACAGCGAACTTCATAATGCCGATACAAATCAGAGGAAAATGAGATG[C/A]CTGTTTATGGCTCTGGACTCTGGAGGAGCTTCTGTGAAAGCAGAGTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link