si:ch211-153j24.3

Ensembl ID:
ENSDARG00000068428
ZFIN ID:
ZDB-GENE-041014-38
Description:
Novel protein similar to vertebrate FOS-like antigen 2 protein (FOSL2) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
FOS
Human Description:
FBJ murine osteosarcoma viral oncogene homolog [Source:HGNC Symbol;Acc:3796]
Mouse Orthologue:
Fos
Mouse Description:
FBJ osteosarcoma oncogene Gene [Source:MGI Symbol;Acc:MGI:95574]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37154 Nonsense Mutation detected in F1 DNA During 2017
sa43527 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098968 Nonsense 33 135 1 6
ENSDART00000122115 Nonsense 75 312 2 4
ENSDART00000134163 Nonsense 42 101 1 3
Genomic Location (Zv9):
Chromosome 20 (position 46811798)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46657081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGTGGATGGTCCTGTCGACTGACATCTCTTCAGTGTCACCCTGCAGA[C/T]AGCAGAAAACACAGAGCTCATCTCACTCCACAGATGCCAAAGCTGCTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098968 Nonsense 34 135 1 6
ENSDART00000122115 Nonsense 76 312 2 4
ENSDART00000134163 Nonsense 43 101 1 3
Genomic Location (Zv9):
Chromosome 20 (position 46811801)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46657084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGATGGTCCTGTCGACTGACATCTCTTCAGTGTCACCCTGCAGACAG[C/T]AGAAAACACAGAGCTCATCTCACTCCACAGATGCCAAAGCTGCTCGAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link