ENSDARG00000068422

Ensembl ID:
ENSDARG00000068422
Human Orthologue:
QRFPR
Human Description:
pyroglutamylated RFamide peptide receptor [Source:HGNC Symbol;Acc:15565]
Mouse Orthologues:
C130060K24Rik, Qrfpr
Mouse Descriptions:
pyroglutamylated RFamide peptide receptor Gene [Source:MGI Symbol;Acc:MGI:2677633]
RIKEN cDNA C130060K24 gene Gene [Source:MGI Symbol;Acc:MGI:2441881]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35378 Nonsense Mutation detected in F1 DNA During 2017
sa38911 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098961 Nonsense 30 358 1 6
Genomic Location (Zv9):
Chromosome 12 (position 49152192)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47925447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACTCCTGCAGTACTATAACCTCTCCCGGCAGGAATTCATCGACACCTA[C/A]AACATCCAGCCGCTGGTCTACATCCCTGAGCTCCCCGCCGGAGTCAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098961 Essential Splice Site 270 358 5 6
Genomic Location (Zv9):
Chromosome 12 (position 49128124)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47809787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAATGACCTGTGGTGATTGAACAGAATCATACCTGTGTGGTTCAAACA[G/T]GAAGAAGAAACGAGCTGTAAAAATGATGATCACCATCGTCCTGCTGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link