ptgesl

Ensembl ID:
ENSDARG00000068415
ZFIN ID:
ZDB-GENE-040426-1063
Description:
Prostaglandin E synthase 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUC7]
Human Orthologue:
PTGES2
Human Description:
prostaglandin E synthase 2 [Source:HGNC Symbol;Acc:17822]
Mouse Orthologue:
Ptges2
Mouse Description:
prostaglandin E synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1917592]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10731 Nonsense Available for shipment Available now
sa41245 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098936 Nonsense 111 377 2 7
ENSDART00000129882 Nonsense 112 378 2 7

The following transcripts of ENSDARG00000068415 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31856838)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30999564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGTTTCAGGCATCAGATCTGGACACAGACCTGAAATTGACTCTCTAT[C/T]AGTATAAGACCTGTCCGTTTTGCAGCAAAGTGCGAGCTTTCCTGGATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098936 Nonsense 244 377 5 7
ENSDART00000129882 Nonsense 245 378 5 7

The following transcripts of ENSDARG00000068415 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31858973)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31001699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTATTTCTCAGAGAAGAGATTAAATGGCGGACATGGGCAGATGATTG[G/A]CTGGTGCATCTAATTTCCCCAAATGTTTACCGGACGCCAACTGAAGCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link