yap1

Ensembl ID:
ENSDARG00000068401
ZFIN ID:
ZDB-GENE-030131-9710
Description:
Yes-associated protein 1 [Source:RefSeq peptide;Acc:NP_001132952]
Human Orthologue:
WWTR1
Human Description:
WW domain containing transcription regulator 1 [Source:HGNC Symbol;Acc:24042]
Mouse Orthologue:
Wwtr1
Mouse Description:
WW domain containing transcription regulator 1 Gene [Source:MGI Symbol;Acc:MGI:1917649]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23349 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23348 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098914 Essential Splice Site 186 442 3 8
Genomic Location:
Chromosome 18 (position 35652897)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGCCCAGTGCCTGTGCAGCAACAGAACATCATGAACCCAGCCTCAGG[T/G]CAGCGGCTCCAGACACTTATTTCATATTAAAAACTACACTCTCAGCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098914 Essential Splice Site 326 442 6 8
Genomic Location:
Chromosome 18 (position 35635056)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGACGCCCGTAACATGACCACCAACAGCTCTGACCCTTTCTTGAACAG[G/A]TAAGACACATTCAGCTGCACGCAGAACACTGGTTATTCAAGAAAAGCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/63aykr06