yap1

Ensembl ID:
ENSDARG00000068401
ZFIN ID:
ZDB-GENE-030131-9710
Description:
Yes-associated protein 1 [Source:RefSeq peptide;Acc:NP_001132952]
Human Orthologue:
WWTR1
Human Description:
WW domain containing transcription regulator 1 [Source:HGNC Symbol;Acc:24042]
Mouse Orthologue:
Wwtr1
Mouse Description:
WW domain containing transcription regulator 1 Gene [Source:MGI Symbol;Acc:MGI:1917649]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23349 Essential Splice Site Available for shipment Available now
sa23348 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098914 Essential Splice Site 186 442 3 8
Genomic Location (Zv9):
Chromosome 18 (position 35652897)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37332053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGCCCAGTGCCTGTGCAGCAACAGAACATCATGAACCCAGCCTCAGG[T/G]CAGCGGCTCCAGACACTTATTTCATATTAAAAACTACACTCTCAGCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098914 Essential Splice Site 326 442 6 8
Genomic Location (Zv9):
Chromosome 18 (position 35635056)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37314212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGACGCCCGTAACATGACCACCAACAGCTCTGACCCTTTCTTGAACAG[G/A]TAAGACACATTCAGCTGCACGCAGAACACTGGTTATTCAAGAAAAGCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link