TENC1 (2 of 2)

Ensembl ID:
ENSDARG00000068397
Description:
tensin like C1 domain containing phosphatase (tensin 2) [Source:HGNC Symbol;Acc:19737]
Human Orthologue:
TENC1
Human Description:
tensin like C1 domain containing phosphatase (tensin 2) [Source:HGNC Symbol;Acc:19737]
Mouse Orthologue:
Tenc1
Mouse Description:
tensin like C1 domain-containing phosphatase Gene [Source:MGI Symbol;Acc:MGI:2387586]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20760 Essential Splice Site Available for shipment Available now
sa30625 Nonsense Mutation detected in F1 DNA During 2016
sa2310 Nonsense F2 line generated During 2016
sa38565 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098906 Essential Splice Site 75 1333 2 21
Genomic Location (Zv9):
Chromosome 6 (position 38968162)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39039762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATAAATCTGTCAGAGAAACGTCATGACATCTGCAGGCTAAACCCAAAG[G/A]TATCTTCCTAATTTTAGATGTGCATAAAACCTCTTTTAAATGTCTCTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098906 Nonsense 91 1333 3 21
Genomic Location (Zv9):
Chromosome 6 (position 38968012)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39039612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGGTTGAGGAGTTTGGGTGGCCTGATTTGCATGCCCCGCCCCTCGAT[A/T]AAATATGTGCCGTATGCAAGACTATGGAGAACTGGCTTAACTCTGACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2310
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098906 Nonsense 623 1333 12 21
Genomic Location (Zv9):
Chromosome 6 (position 38957401)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39029001
KASP Assay ID:
554-3083.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCACAACATCACCAACTTCATGCTCTTGTCGGGATTGTTTACGATTA[C/T]GAGAGGATGTTGCCCTCCATTCTTTACGAGGAAGGGAATTAGAAACCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098906 Nonsense 955 1333 14 21
Genomic Location (Zv9):
Chromosome 6 (position 38954791)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39026391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCTGATGGCTTCATCACACCCTCATTTCCTATAGCATCACACGGCTA[T/A]CCTCTTCTGACGGTGCCTCATGTCCCCTACACAGGCTACACTGAGATCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link