LOC100333117

Ensembl ID:
ENSDARG00000068386
Human Orthologue:
CYLD
Human Description:
cylindromatosis (turban tumor syndrome) [Source:HGNC Symbol;Acc:2584]
Mouse Orthologue:
Cyld
Mouse Description:
cylindromatosis (turban tumor syndrome) Gene [Source:MGI Symbol;Acc:MGI:1921506]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33993 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098879 Essential Splice Site 82 251 3 7
ENSDART00000130859 Essential Splice Site 20 188 1 5
Genomic Location (Zv9):
Chromosome 7 (position 1615030)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 1315962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCATTCTGCCCTCACTGACCCTCGACATCACAGACTTGCTGGACGAGA[G/A]TGAGCATATAGACTGTTTTATTTATGGTTTATTTTTCACCTTAATAACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
  • Crohn's disease: A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci. (View Study)
  • Leprosy: Identification of two new loci at IL23R and RAB32 that influence susceptibility to leprosy. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link