tpm2

Ensembl ID:: ENSDARG00000068385
ZFIN ID:: ZDB-GENE-040625-114
Description:: tropomyosin beta chain [Source:RefSeq peptide;Acc:NP_001002119]
Human Orthologue:: TPM2
Human Description:: tropomyosin 2 (beta) [Source:HGNC Symbol;Acc:12011]
Mouse Orthologue:: Tpm2
Mouse Description:: tropomyosin 2, beta Gene [Source:MGI Symbol;Acc:MGI:98810]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa18509	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa18509
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000098875	Nonsense	197	284	6	9
ENSDART00000132715		None	182	None	6
ENSDART00000136769		None	248	None	8
ENSDART00000140580	Nonsense	197	233	6	7

The following transcripts of ENSDARG00000068385 do not overlap with this mutation:

ENSDART00000146196

Genomic Location:: Chromosome 10 (position 8339611)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: YCCTGCATCCTTGWTKTGGTACAGCAAATCTGGTGACCTTGAAGAAGAGT[T/A]GAAAAATGTCACCAACAATTTGAAGTCCCTGGAAGCTCAGGCAGAGAAGG
Associated Phenotype:: Not determined

OMIM

More OMIM information for TPM2

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: