tpm2

Ensembl ID:
ENSDARG00000068385
ZFIN ID:
ZDB-GENE-040625-114
Description:
tropomyosin beta chain [Source:RefSeq peptide;Acc:NP_001002119]
Human Orthologue:
TPM2
Human Description:
tropomyosin 2 (beta) [Source:HGNC Symbol;Acc:12011]
Mouse Orthologue:
Tpm2
Mouse Description:
tropomyosin 2, beta Gene [Source:MGI Symbol;Acc:MGI:98810]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18509 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098875 Nonsense 197 284 6 9
ENSDART00000132715 None None 182 None 6
ENSDART00000136769 None None 248 None 8
ENSDART00000140580 Nonsense 197 233 6 7

The following transcripts of ENSDARG00000068385 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 8339611)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCCTGCATCCTTGWTKTGGTACAGCAAATCTGGTGACCTTGAAGAAGAGT[T/A]GAAAAATGTCACCAACAATTTGAAGTCCCTGGAAGCTCAGGCAGAGAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dskphu8j