
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tpm2
- Ensembl ID:
- ENSDARG00000068385
- ZFIN ID:
- ZDB-GENE-040625-114
- Description:
- tropomyosin beta chain [Source:RefSeq peptide;Acc:NP_001002119]
- Human Orthologue:
- TPM2
- Human Description:
- tropomyosin 2 (beta) [Source:HGNC Symbol;Acc:12011]
- Mouse Orthologue:
- Tpm2
- Mouse Description:
- tropomyosin 2, beta Gene [Source:MGI Symbol;Acc:MGI:98810]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18509 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa18509
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098875 | Nonsense | 197 | 284 | 6 | 9 |
ENSDART00000132715 | None | 182 | None | 6 | |
ENSDART00000136769 | None | 248 | None | 8 | |
ENSDART00000140580 | Nonsense | 197 | 233 | 6 | 7 |
The following transcripts of ENSDARG00000068385 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 8339611)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 6352773 GRCz11 10 6353982 - KASP Assay ID:
- 2260-2906.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- YCCTGCATCCTTGWTKTGGTACAGCAAATCTGGTGACCTTGAAGAAGAGT[T/A]GAAAAATGTCACCAACAATTTGAAGTCCCTGGAAGCTCAGGCAGAGAAGG
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: