pglyrp5

Ensembl ID:
ENSDARG00000068382
ZFIN ID:
ZDB-GENE-050419-71
Description:
PGRP-SC1a protein [Source:RefSeq peptide;Acc:NP_001037786]
Human Orthologues:
PGLYRP1, PGLYRP3, PGLYRP4
Human Descriptions:
peptidoglycan recognition protein 1 [Source:HGNC Symbol;Acc:8904]
peptidoglycan recognition protein 3 [Source:HGNC Symbol;Acc:30014]
peptidoglycan recognition protein 4 [Source:HGNC Symbol;Acc:30015]
Mouse Orthologues:
Pglyrp1, Pglyrp3, Pglyrp4
Mouse Descriptions:
peptidoglycan recognition protein 1 Gene [Source:MGI Symbol;Acc:MGI:1345092]
peptidoglycan recognition protein 3 Gene [Source:MGI Symbol;Acc:MGI:2685266]
peptidoglycan recognition protein 4 Gene [Source:MGI Symbol;Acc:MGI:2686324]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39212 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064848 Essential Splice Site 133 238 3 4
Genomic Location (Zv9):
Chromosome 18 (position 39200749)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40913466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCAACAGGGTGGACTCTGTACATTGACTCTGTCCTTCTTACTTCTTT[A/G]GCTTTCTAATATCTGGAGATGGGACGGTGTATGAAGGCAGAGGATGGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link