foxg1c

Ensembl ID:
ENSDARG00000068380
ZFIN ID:
ZDB-GENE-050419-26
Description:
forkhead box G1c [Source:RefSeq peptide;Acc:NP_001038680]
Human Orthologue:
FOXG1
Human Description:
forkhead box G1 [Source:HGNC Symbol;Acc:3811]
Mouse Orthologues:
3110039M20Rik, Foxg1
Mouse Descriptions:
forkhead box G1 Gene [Source:MGI Symbol;Acc:MGI:1347464]
RIKEN cDNA 3110039M20 gene Gene [Source:MGI Symbol;Acc:MGI:1914543]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36711 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098868 Nonsense 40 296 1 2
ENSDART00000139352 Nonsense 105 379 1 1
Genomic Location (Zv9):
Chromosome 18 (position 39198486)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40911203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGATAAGCCTCCGTTCAGTTATAACGCGCTTATCATGATGGCCATCCGC[C/T]AGAGCCCGGAGCGGCGGCTCACCCTCAACGGCATCTACGAGTTCATCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link