si:ch211-132b12.5

Ensembl ID:
ENSDARG00000068372
ZFIN IDs:
ZDB-GENE-050419-27, ZDB-GENE-061215-110, ZDB-GENE-061215-110
Description:
hypothetical protein LOC790932 [Source:RefSeq peptide;Acc:NP_001073546]
Human Orthologues:
SLC6A11, SLC6A12, SLC6A13
Human Descriptions:
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 [Source:HGNC Symbol;
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 [Source:HGNC Symbol;Acc:1104
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 [Source:HGNC Symbol;Acc:1104
Mouse Orthologues:
Slc6a11, Slc6a12, Slc6a13
Mouse Descriptions:
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 Gene [Source:MGI Sym
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 Gene [Source:MGI Symbol;Acc:
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 Gene [Source:MGI Symbol;Acc:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23362 Essential Splice Site Available for shipment Available now
sa36710 Nonsense Mutation detected in F1 DNA During 2017
sa43160 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040160 Essential Splice Site 335 620 8 14
ENSDART00000049423 Essential Splice Site 294 579 8 14

The following transcripts of ENSDARG00000068372 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 38927060)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40639777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTTGCAGAATCTGTTGCAATGATGCTTTTTATAATCTATATCCATC[A/T]GGGACTGCTTTTGGCTTTGCCTTCTGAACAGTGGCACCAGTTTTGTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040160 Nonsense 385 620 9 14
ENSDART00000049423 Nonsense 344 579 9 14

The following transcripts of ENSDARG00000068372 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 38927295)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40640012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAGATCTCTCTGTTTCTCTTAGGCCCAGGACTAGCATTCATTGCTTA[T/A]CCACAGGCAGTAGCTATGATGCCTTTTCCTCAGTTGTGGGCTGTTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040160 Essential Splice Site 414 620 9 14
ENSDART00000049423 Essential Splice Site 373 579 9 14

The following transcripts of ENSDARG00000068372 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 38927383)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40640100
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCTGTTTGTTTTTTCATCATGATTATTTTGCTTGGCCTAGACACACAG[G/A]TAAGCTGAAACTAACCTCCTTAATGTTTCTTTAAAGCATTTGGAAGTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link