ralgps1

Ensembl ID:
ENSDARG00000068370
ZFIN ID:
ZDB-GENE-070720-16
Description:
Ras-specific guanine nucleotide-releasing factor RalGPS1 [Source:UniProtKB/Swiss-Prot;Acc:B0UXH6]
Human Orthologue:
RALGPS1
Human Description:
Ral GEF with PH domain and SH3 binding motif 1 [Source:HGNC Symbol;Acc:16851]
Mouse Orthologue:
Ralgps1
Mouse Description:
Ral GEF with PH domain and SH3 binding motif 1 Gene [Source:MGI Symbol;Acc:MGI:1922008]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2479 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3669 Nonsense Mutation detected in F1 DNA During 2014
sa17125 Essential Splice Site Available for shipment Available now
sa1127 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa2479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098840 Essential Splice Site None 581 2 21
Genomic Location:
Chromosome 8 (position 33951014)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGCCATGCAGATATTAGCCATGTGAAAGATCTGGCCAATCAAAATGGG[T/A]ATGCAAATCCATACGTTACACTAAAAMGTGTTATGTGTACAAATCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098840 Nonsense 227 581 10 21
Genomic Location:
Chromosome 8 (position 33797606)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTACATTGACTCCGCCTACCCTGCTTCTGACAGCATCATCGAGACAGAG[C/T]AAAGAACCAATCAGATGAACAATCTACTCCGCATCATTTCCGATCTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17125
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098840 Essential Splice Site 280 581 11 21
Genomic Location:
Chromosome 8 (position 33797282)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCRCTACATCGAGGAGCTCCAGAAGTTTGTGGAGGATGACAAYTACTCG[T/C]AAGTGACATAAACCCATTATTATGCTCAGTAGCTTTAATTTAGCTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1127
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098840 Essential Splice Site 413 581 15 21
Genomic Location:
Chromosome 8 (position 33778444)
KASP Assay ID:
554-1038.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTAGAGAGAGCTCTTTTAGTGATGAATTATCAAGTACTGTTGAGAGG[T/C]AAGGCCAATTAAAGATTATTATGAATCAGAATAKAAGATTGATTGATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v6q8ekpx