angptl2

Ensembl ID:
ENSDARG00000068369
ZFIN ID:
ZDB-GENE-050624-1
Description:
angiopoietin-like 2 isoform 1 [Source:RefSeq peptide;Acc:NP_001119950]
Human Orthologue:
ANGPTL2
Human Description:
angiopoietin-like 2 [Source:HGNC Symbol;Acc:490]
Mouse Orthologue:
Angptl2
Mouse Description:
angiopoietin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1347002]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9722 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098836 Nonsense 455 510 4 4
ENSDART00000131660 Nonsense 464 519 4 4
Genomic Location:
Chromosome 8 (position 33897388)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAATAAATRTTTTTTCAGGGAACTGTGCCCACTATCAAAAGGGAGGCTG[G/A]TGGTATAACGCCTGTGCTCACTCTAATCTGAACGGCGTGTGGTACAGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y06fyup7