lmx1b.1

Ensembl ID:
ENSDARG00000068365
ZFIN ID:
ZDB-GENE-050114-2
Description:
LIM homeobox transcription factor 1, beta 1 [Source:RefSeq peptide;Acc:NP_001020338]
Human Orthologue:
LMX1B
Human Description:
LIM homeobox transcription factor 1, beta [Source:HGNC Symbol;Acc:6654]
Mouse Orthologue:
Lmx1b
Mouse Description:
LIM homeobox transcription factor 1 beta Gene [Source:MGI Symbol;Acc:MGI:1100513]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5493 Nonsense Mutation detected in F1 DNA During 2014
sa3688 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14923 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076420 Nonsense 37 375 3 9
ENSDART00000098825 None None 168 3 6
ENSDART00000127460 Nonsense 37 375 2 8

The following transcripts of ENSDARG00000068365 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 34228378)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTACCCTYCAGGGACGGAGTGCCATCACCAGGCGGTGTGTGAGGGGTGC[C/T]AGCGGCCGATATCCGACCGCTTTCTGATGCGCGTCAACGAGTCTTCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076420 Essential Splice Site 248 375 None 9
ENSDART00000098825 None None 168 None 6
ENSDART00000127460 Essential Splice Site 248 375 None 8

The following transcripts of ENSDARG00000068365 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 34126587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGAGCGTACGCGTGGTTCAAGTGTGGTTCCAGAACCAAAGAGCTAAGG[T/C]GAGTCCAGGTCTTGTACACTACAATATGAATYATCCAGTATTACCCGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076420 Nonsense 323 375 8 9
ENSDART00000098825 None None 168 None 6
ENSDART00000127460 Nonsense 323 375 7 8

The following transcripts of ENSDARG00000068365 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 34115079)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGGGCCTCACCCCTCCTCAGATGCCCGGTGACCACATGAACCCATA[T/A]GGTGAGCATCAACCATTGAGTTGTGTCATRTTAGMGTGTGTGTGTGTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mefi6yp6