mmab

Ensembl ID:
ENSDARG00000068344
ZFIN ID:
ZDB-GENE-060526-232
Description:
cob(I)yrinic acid a,c-diamide adenosyltransferase, mitochondrial [Source:RefSeq peptide;Acc:NP_0010
Human Orthologue:
MMAB
Human Description:
methylmalonic aciduria (cobalamin deficiency) cblB type [Source:HGNC Symbol;Acc:19331]
Mouse Orthologue:
Mmab
Mouse Description:
methylmalonic aciduria (cobalamin deficiency) type B homolog (human) Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6965 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098795 Nonsense 232 233 9 9

The following transcripts of ENSDARG00000068344 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 21273097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGATATGCTGCAATGAAAGAYGGTAATGCAGAAACCATYTACAAAAGG[C/T]AGGAMTAAAGGACGAAGACAGCAAACTTGAATTTGAACAATTTGTTTATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aoxpf49n