A5PMT7_DANRE

Ensembl ID:
ENSDARG00000068288
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5PMT7]
Human Orthologue:
LAMC2
Human Description:
laminin, gamma 2 [Source:HGNC Symbol;Acc:6493]
Mouse Orthologue:
Lamc2
Mouse Description:
laminin, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:99913]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19815 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098706 Nonsense 673 1182 13 22
Genomic Location:
Chromosome 2 (position 35732558)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAATATATGTTTTAAGAATTGTTTTGTGCCAAACAGACACGGAGAAA[C/T]AGCTTCAGGATAAACTGGCGAGCATTAGCCGATCTCAGCTGAGGGAGGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u1973jiw