si:ch211-240b21.2

Ensembl ID:
ENSDARG00000068279
ZFIN ID:
ZDB-GENE-060526-125
Description:
Novel hAT family dimerisation domain protein [Source:UniProtKB/TrEMBL;Acc:A2BGL2]
Human Orthologue:
PRKRIR
Human Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
Mouse Orthologue:
Prkrir
Mouse Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26445 Nonsense Mutation detected in F1 DNA During 2017
sa26446 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098684 Nonsense 294 643 3 7
ENSDART00000141368   None 222 None 3
Genomic Location (Zv9):
Chromosome 5 (position 22476707)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20189579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCACATCAACTCAACCTAATAATGCAACAGGCCACTTCTAACATTTCC[A/T]AAGTGAGAATTTTTTTTTTCTGACCTTGGAGGATTTTCCAGCTTTTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098684 Nonsense 308 643 4 7
ENSDART00000141368   None 222 None 3
Genomic Location (Zv9):
Chromosome 5 (position 22476763)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20189635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATTTTTTTTTTCTGACCTTGGAGGATTTTCCAGCTTTTTTTCAAGAT[C/A]ACCCAAACGCACAGACGTCCTTGATAAAGTAGTGGCCCATAGACTACCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link