si:ch211-272f3.3

Ensembl ID:
ENSDARG00000068275
ZFIN ID:
ZDB-GENE-030131-8720
Description:
Novel protein similar to vertebrate pentaxin-related [Source:UniProtKB/TrEMBL;Acc:A3KPN4]
Human Orthologue:
PTX3
Human Description:
pentraxin 3, long [Source:HGNC Symbol;Acc:9692]
Mouse Orthologue:
Ptx3
Mouse Description:
pentraxin related gene Gene [Source:MGI Symbol;Acc:MGI:104641]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17589 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098673 Nonsense 150 447 2 3
Genomic Location (Zv9):
Chromosome 18 (position 39712606)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41382103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGCCTGCAGAACGCACTGGACCGTGCGCGAGAGGTTTCAGCTGATCGGTA[C/A]GAGCAGCATGATGCAGTCCTRCAGCAGCTACTGGCAGTCAGCGTAAACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link