si:ch211-203b8.6

Ensembl ID:
ENSDARG00000068274
ZFIN ID:
ZDB-GENE-050419-160
Description:
hypothetical protein LOC566073 [Source:RefSeq peptide;Acc:NP_001122202]
Human Orthologues:
ANKRD28, ANKRD44, ANKRD50, ANKRD52
Human Descriptions:
ankyrin repeat domain 28 [Source:HGNC Symbol;Acc:29024]
ankyrin repeat domain 44 [Source:HGNC Symbol;Acc:25259]
ankyrin repeat domain 50 [Source:HGNC Symbol;Acc:29223]
ankyrin repeat domain 52 [Source:HGNC Symbol;Acc:26614]
Mouse Orthologues:
Ankrd28, Ankrd44, Ankrd50, Ankrd52, E230028L10Rik
Mouse Descriptions:
ankyrin repeat domain 28 Gene [Source:MGI Symbol;Acc:MGI:2145661]
ankyrin repeat domain 44 Gene [Source:MGI Symbol;Acc:MGI:3045243]
ankyrin repeat domain 50 Gene [Source:MGI Symbol;Acc:MGI:2139777]
ankyrin repeat domain 52 Gene [Source:MGI Symbol;Acc:MGI:2444029]
RIKEN cDNA E230028L10 gene Gene [Source:MGI Symbol;Acc:MGI:2685285]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10309 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098671 Nonsense 403 422 5 5
ENSDART00000128495 Nonsense 403 422 4 4
Genomic Location (Zv9):
Chromosome 18 (position 39849719)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41519216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARGACATCGCGAGAGCACACAATCAGCTAGCCGTCATCCAGCTCCTTCAA[C/T]AACACCAGACGGTCAGCATGAGGGAACAAGCTCAGGACAGTATACAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link