grhpra

Ensembl ID:
ENSDARG00000068264
ZFIN ID:
ZDB-GENE-040724-230
Description:
glyoxylate reductase/hydroxypyruvate reductase [Source:RefSeq peptide;Acc:NP_001018361]
Human Orthologue:
GRHPR
Human Description:
glyoxylate reductase/hydroxypyruvate reductase [Source:HGNC Symbol;Acc:4570]
Mouse Orthologue:
Grhpr
Mouse Description:
glyoxylate reductase/hydroxypyruvate reductase Gene [Source:MGI Symbol;Acc:MGI:1923488]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22536 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098640 Nonsense 96 327 3 9
Genomic Location (Zv9):
Chromosome 14 (position 47008510)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 44325637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTCTCTCCGTGGGATTTGACCACCTCGCTATTGATGAGATCAAGAAA[C/T]GGTGAGTATGTCTTTCAGTAAGCCATCAGACTTTTAGAAAAAGAGCAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link