si:ch211-243k12.1

Ensembl ID:
ENSDARG00000068247
ZFIN IDs:
ZDB-GENE-060503-278, ZDB-GENE-091113-29
Description:
Leucine zipper protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A5D8S1]
Human Orthologue:
LUZP2
Human Description:
leucine zipper protein 2 [Source:HGNC Symbol;Acc:23206]
Mouse Orthologue:
Luzp2
Mouse Description:
leucine zipper protein 2 Gene [Source:MGI Symbol;Acc:MGI:1889615]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36700 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111301   None 311 None 11
ENSDART00000146120 Nonsense 276 346 10 12
Genomic Location (Zv9):
Chromosome 18 (position 36285434)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37867137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGGATCACAACAACAAGTAAATTGCCTGTGAGCAGTGCGGTAATGAGG[A/T]GAGAGAGCACGGGGCCCAAAGACTGCCAGATGGTGAAGGTAAATCTTTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Alzheimer's disease (late onset): Genome-wide association and linkage study in the Amish detects a novel candidate late-onset Alzheimer disease gene. (View Study)
  • Intelligence: Genome-wide association study of intelligence: additive effects of novel brain expressed genes. (View Study)
  • Iron status biomarkers: Variants in TF and HFE explain approximately 40% of genetic variation in serum-transferrin levels. (View Study)
  • Magnesium levels: Genome-wide association studies of serum magnesium, potassium, and sodium concentrations identify six Loci influencing serum magnesium levels. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link