plcb3

Ensembl ID:
ENSDARG00000068246
ZFIN ID:
ZDB-GENE-030616-594
Description:
1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase beta-3 [Source:RefSeq peptide;Acc:NP_0011
Human Orthologue:
PLCB3
Human Description:
phospholipase C, beta 3 (phosphatidylinositol-specific) [Source:HGNC Symbol;Acc:9056]
Mouse Orthologue:
Plcb3
Mouse Description:
phospholipase C, beta 3 Gene [Source:MGI Symbol;Acc:MGI:104778]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21109 Essential Splice Site Available for shipment Available now
sa15031 Essential Splice Site Available for shipment Available now
sa9679 Nonsense Available for shipment Available now
sa41058 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12809 Nonsense Available for shipment Available now
sa15264 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21109
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098563 Essential Splice Site 33 1244 1 34

The following transcripts of ENSDARG00000068246 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 60827236)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 60046201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCAATGAGGTCCTCAAACGGGGGAGCAAGTTTATCAAATGGGACGAG[G/A]TAAGAAGATCGCGTCCGTCTGTGATTGTTATGTGGCGTGATACTTGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098563 Essential Splice Site 497 1244 14 34

The following transcripts of ENSDARG00000068246 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 60759041)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59978006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCATCCGACGCAAGGATGGGACAGAYGAACAGTCTTCACCTTTGAATGG[T/C]GTGTGTACACATGCWAGCATACCAAAATATAACCTMATCTGCTCCAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098563 Nonsense 726 1244 21 34

The following transcripts of ENSDARG00000068246 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 60750769)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59969734
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAGATCATCTCAGGCCAGTTTCTAAATGATAAGAAGGTTGGTGTTTA[T/A]GTGGAGGTGGACATGTTTGGGCTTCCTGCAGACACTAAAAGGAAATATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098563 Essential Splice Site 765 1244 21 34

The following transcripts of ENSDARG00000068246 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 60750651)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59969616
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACTCTCTGGACCCAGTCTGGGATGATGAAACCTTTGTGTTCAATAAG[G/A]TTTGAAACTAAAGTAATATTTTACCCAAAATTTGCAATTCTGTCATGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098563 Nonsense 779 1244 22 34

The following transcripts of ENSDARG00000068246 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 60750485)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59969450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTCTAGGTGGTGTTACCTACGCTAGCATCTCTGAGAGTGGCGGTATA[T/G]GAAGAAAACGGAAAGTTTATTGGTCATCGTATCTTGCCAGTGTCAGCGTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098563 Nonsense 796 1244 22 34

The following transcripts of ENSDARG00000068246 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 60750435)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59969400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KGAAGAAAACGGAAAGTTTATTGGTCATCGTATCTTGCCAGTGTCAGCGT[T/A]GCGCCCAGGTGCCTATRCATGGCAGTAATCTCGCTAGTCNNNNNNNNNAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link