
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
accn2c
- Ensembl ID:
- ENSDARG00000068245
- ZFIN ID:
- ZDB-GENE-040513-3
- Human Orthologue:
- ACCN3
- Human Description:
- amiloride-sensitive cation channel 3 [Source:HGNC Symbol;Acc:101]
- Mouse Orthologues:
- Accn2, Accn3
- Mouse Descriptions:
- amiloride-sensitive cation channel 2, neuronal Gene [Source:MGI Symbol;Acc:MGI:1194915]
- amiloride-sensitive cation channel 3 Gene [Source:MGI Symbol;Acc:MGI:2159339]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44171 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37929 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa24532 | Nonsense | Available for shipment | Available now |
sa24531 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa44171
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050602 | Nonsense | 256 | 501 | 5 | 10 |
ENSDART00000131708 | Nonsense | 4 | 249 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 24 (position 35135818)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 33987267 GRCz11 24 33873442 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACAGCTTTATCCTGGCAGTAATGAATATGGCTTTATTGCAGCTGCTGTA[T/A]CTTCCTCCGCCGTGGGGCGACTGCAGATCCGCACCGATGGACTCGGAGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37929
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050602 | Nonsense | 290 | 501 | 5 | 10 |
ENSDART00000131708 | Nonsense | 38 | 249 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 24 (position 35135716)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 33987165 GRCz11 24 33873340 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTCCACTTACAGCATCACTGCCTGCCGGATCGACTGCGAGACCCGATA[C/A]CTGCTGGAGAACTGCAACTGCAGGATGGTGCACATGCCAGGTGCTGAGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24532
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050602 | Nonsense | 423 | 501 | 9 | 10 |
ENSDART00000131708 | Nonsense | 171 | 249 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 24 (position 35132065)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 33983514 GRCz11 24 33869689 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATCGGTGGTCAGATGGGTCTGTTTATAGGAGCCAGTGTATTGACTATAT[T/A]GGAGATATTTGATTATTTGTATGAGGTTTGTTGTGGATTTGCTTTTTCTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24531
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050602 | Essential Splice Site | 431 | 501 | 9 | 10 |
ENSDART00000131708 | Essential Splice Site | 179 | 249 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 24 (position 35132039)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 33983488 GRCz11 24 33869663 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGGAGCCAGTGTATTGACTATATTGGAGATATTTGATTATTTGTATGAG[G/A]TTTGTTGTGGATTTGCTTTTTCTACTTCTCCTGTAATGTGCTGATGGTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: