accn2c

Ensembl ID:
ENSDARG00000068245
ZFIN ID:
ZDB-GENE-040513-3
Human Orthologue:
ACCN3
Human Description:
amiloride-sensitive cation channel 3 [Source:HGNC Symbol;Acc:101]
Mouse Orthologues:
Accn2, Accn3
Mouse Descriptions:
amiloride-sensitive cation channel 2, neuronal Gene [Source:MGI Symbol;Acc:MGI:1194915]
amiloride-sensitive cation channel 3 Gene [Source:MGI Symbol;Acc:MGI:2159339]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44171 Nonsense Mutation detected in F1 DNA During 2016
sa37929 Nonsense Mutation detected in F1 DNA During 2016
sa24532 Nonsense Mutation detected in F1 DNA During 2016
sa24531 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050602 Nonsense 256 501 5 10
ENSDART00000131708 Nonsense 4 249 1 6
Genomic Location (Zv9):
Chromosome 24 (position 35135818)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33987267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGCTTTATCCTGGCAGTAATGAATATGGCTTTATTGCAGCTGCTGTA[T/A]CTTCCTCCGCCGTGGGGCGACTGCAGATCCGCACCGATGGACTCGGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050602 Nonsense 290 501 5 10
ENSDART00000131708 Nonsense 38 249 1 6
Genomic Location (Zv9):
Chromosome 24 (position 35135716)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33987165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCCACTTACAGCATCACTGCCTGCCGGATCGACTGCGAGACCCGATA[C/A]CTGCTGGAGAACTGCAACTGCAGGATGGTGCACATGCCAGGTGCTGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050602 Nonsense 423 501 9 10
ENSDART00000131708 Nonsense 171 249 5 6
Genomic Location (Zv9):
Chromosome 24 (position 35132065)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33983514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCGGTGGTCAGATGGGTCTGTTTATAGGAGCCAGTGTATTGACTATAT[T/A]GGAGATATTTGATTATTTGTATGAGGTTTGTTGTGGATTTGCTTTTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050602 Essential Splice Site 431 501 9 10
ENSDART00000131708 Essential Splice Site 179 249 5 6
Genomic Location (Zv9):
Chromosome 24 (position 35132039)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33983488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGAGCCAGTGTATTGACTATATTGGAGATATTTGATTATTTGTATGAG[G/A]TTTGTTGTGGATTTGCTTTTTCTACTTCTCCTGTAATGTGCTGATGGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link