accn2c

Ensembl ID:
ENSDARG00000068245
ZFIN ID:
ZDB-GENE-040513-3
Human Orthologue:
ACCN3
Human Description:
amiloride-sensitive cation channel 3 [Source:HGNC Symbol;Acc:101]
Mouse Orthologues:
Accn2, Accn3
Mouse Descriptions:
amiloride-sensitive cation channel 2, neuronal Gene [Source:MGI Symbol;Acc:MGI:1194915]
amiloride-sensitive cation channel 3 Gene [Source:MGI Symbol;Acc:MGI:2159339]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24532 Nonsense Mutation detected in F1 DNA During 2014
sa24531 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050602 Nonsense 423 501 9 10
ENSDART00000131708 Nonsense 171 249 5 6
Genomic Location:
Chromosome 24 (position 35132065)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCGGTGGTCAGATGGGTCTGTTTATAGGAGCCAGTGTATTGACTATAT[T/A]GGAGATATTTGATTATTTGTATGAGGTTTGTTGTGGATTTGCTTTTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050602 Essential Splice Site 431 501 9 10
ENSDART00000131708 Essential Splice Site 179 249 5 6
Genomic Location:
Chromosome 24 (position 35132039)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGAGCCAGTGTATTGACTATATTGGAGATATTTGATTATTTGTATGAG[G/A]TTTGTTGTGGATTTGCTTTTTCTACTTCTCCTGTAATGTGCTGATGGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/obick10g