cngb1a

Ensembl ID:
ENSDARG00000068242
ZFIN ID:
ZDB-GENE-050419-164
Description:
Novel protein similar to vertebrate cyclic nucleotide gated channel beta 1 (CNGB1) [Source:UniProtKB
Mouse Orthologue:
Cngb1
Mouse Description:
cyclic nucleotide gated channel beta 1 Gene [Source:MGI Symbol;Acc:MGI:2664102]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10125 Nonsense Available for shipment Available now
sa2970 Nonsense F2 line generated During 2014
sa12618 Nonsense Available for shipment Available now
sa13410 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10125
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098585 Nonsense 99 708 3 16
ENSDART00000140089 Nonsense 87 613 2 14
Genomic Location:
Chromosome 18 (position 43920366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGAAAGAGSCTGAAGAGAAGCCTGTGGAGGAGGAAGAGGAGGARGTG[C/T]AGATCTAYGARTTCATGGGCTACAAGATCCCAGTTCCCCAATTCAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2970
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098585 Nonsense 145 708 4 16
ENSDART00000140089 Nonsense 133 613 3 14
Genomic Location:
Chromosome 18 (position 43921679)
KASP Assay ID:
554-3090.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCATACACACACTGGTTTCTTCTTGCTCAGATCTGATCTACGTGGTGT[G/A]GCTGTTCTTCGTGACGTTTGCGTGGAACTGGAATGTTTGGCTGATTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098585 Nonsense 378 708 10 16
ENSDART00000140089 Nonsense 366 613 9 14
Genomic Location:
Chromosome 18 (position 43925211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTTCAGATGAGAGACGTGATCGGAGCYGCTACAGCAGGAGAAGCGTA[T/G]TATAGACACTCTGTGGACAGCACTGTCAAATACATGACCTCCTACAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098585 Essential Splice Site 625 708 15 16
ENSDART00000140089 None 613 613 14 14
Genomic Location:
Chromosome 18 (position 43931663)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACARACGTTTTCMCGGCTGAAGGAGGCTTATAAGGGAGCAACYCTAGAG[G/A]TATTTATTTATAGCCTGCTGTCGTGATGCCTTAGGCCAAAAGCATGTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q2ms0n9b