si:ch211-10e2.3

Ensembl ID:
ENSDARG00000068240
ZFIN ID:
ZDB-GENE-070912-10
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R0I3]
Human Orthologues:
TRIM16, TRIM16L, TRIM25, TRIM29, TRIM47, TRIM8
Human Descriptions:
tripartite motif-containing 16 [Source:HGNC Symbol;Acc:17241]
tripartite motif-containing 16-like [Source:HGNC Symbol;Acc:32670]
tripartite motif-containing 25 [Source:HGNC Symbol;Acc:12932]
tripartite motif-containing 29 [Source:HGNC Symbol;Acc:17274]
tripartite motif-containing 47 [Source:HGNC Symbol;Acc:19020]
tripartite motif-containing 8 [Source:HGNC Symbol;Acc:15579]
Mouse Orthologues:
4933422H20Rik, Trim16, Trim25, Trim29, Trim47, Trim8
Mouse Descriptions:
RIKEN cDNA 4933422H20 gene Gene [Source:MGI Symbol;Acc:MGI:3588186]
tripartite motif-containing 16 Gene [Source:MGI Symbol;Acc:MGI:2137356]
tripartite motif-containing 25 Gene [Source:MGI Symbol;Acc:MGI:102749]
tripartite motif-containing 29 Gene [Source:MGI Symbol;Acc:MGI:1919419]
tripartite motif-containing 47 Gene [Source:MGI Symbol;Acc:MGI:1917374]
tripartite motif-containing 8 Gene [Source:MGI Symbol;Acc:MGI:1933302]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39890 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098575 Nonsense 330 499 5 6
ENSDART00000143469   None 261 None 4
ENSDART00000146149 Nonsense 15 189 1 2

The following transcripts of ENSDARG00000068240 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37834065)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38148979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCTACTCGCTGTTTCTATGTGTTATTCAGTAAGCAGCCCATTAACCT[T/A]GGACAAAAACTCAGCTCATCCTCTTCTTAACATCTCTGAAGATCTGCGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link