COL25A1 (1 of 2)

Ensembl ID:
ENSDARG00000068218
Description:
collagen, type XXV, alpha 1 [Source:HGNC Symbol;Acc:18603]
Human Orthologue:
COL25A1
Human Description:
collagen, type XXV, alpha 1 [Source:HGNC Symbol;Acc:18603]
Mouse Orthologue:
Col25a1
Mouse Description:
collagen, type XXV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1924268]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12148 Essential Splice Site Available for shipment Available now
sa14199 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074352 Essential Splice Site 74 291 4 17
Genomic Location:
Chromosome 7 (position 60519908)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGGGAGAGCAAGGGGAATCAGGAGCACCAGGCCTGAAAGGTTCAAAG[G/A]TCAGTMTCTGCTTCTTAGTGAACCATGCATTAGGAAMTTAAAAACAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14199
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074352 Essential Splice Site 89 291 5 17
Genomic Location:
Chromosome 7 (position 60520123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGGGGGATTCAGGAGACAAAGGGGATGTGGGCCCAACAGGATCACAA[G/T]TGAGTAAAGTGTAAAATGATGTAYTTTTTTTTTGACAGGCAAATTTAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2tokmoot