fzd10

Ensembl ID:
ENSDARG00000068213
ZFIN ID:
ZDB-GENE-990415-220
Description:
frizzled 10 isoform 2 [Source:RefSeq peptide;Acc:NP_571211]
Human Orthologue:
FZD10
Human Description:
frizzled homolog 10 (Drosophila) [Source:HGNC Symbol;Acc:4039]
Mouse Orthologue:
Fzd10
Mouse Description:
frizzled homolog 10 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2136761]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18678 Nonsense Available for shipment Available now
sa11027 Nonsense Available for shipment Available now
sa18927 Nonsense Mutation detected in F1 DNA During 2014
sa7618 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098520 Nonsense 71 580 1 1
Genomic Location:
Chromosome 8 (position 45838757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRAACTTAATGGRACATGAAGATCAAAATGAGGCAGCCATAAAGCTGCAT[G/T]AGTTTGCTCCGCTGATTGAGTTCGGCTGTCACAGCCATCTGAAGTTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098520 Nonsense 197 580 1 1
ENSDART00000098520 Nonsense 197 580 1 1
Genomic Location:
Chromosome 8 (position 45839135)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGCCTATTAAAGAGAGGGTCGGTAAGACCACATGCAGCAACCCTGGA[A/T]AGTTTCATTATGTGCARARGAGTGAGTCCTGTRCCCCCAAGTGTTACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098520 Nonsense 197 580 1 1
ENSDART00000098520 Nonsense 197 580 1 1
Genomic Location:
Chromosome 8 (position 45839135)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGCCTATTAAAGAGAGGGTCGGTAAGACCACATGCAGCAACCCTGGA[A/T]AGTTTCATTATGTGCAAAAGAGTGAGTCCTGTGCCCCCAAGTGTTACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098520 Missense 208 580 1 1
Genomic Location:
Chromosome 8 (position 45839168)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGCAGCAACCCTGGAAAGTTTCATTATGTGCARAAGAGTGAGTCCTGT[G/A]CCCCCAAGTGTTACTCCAACGTAGATGTGTACTGGAGCCAGGGCGACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Gambling: Genome-wide association study of a quantitative disordered gambling trait. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wx01c41h