haus6

Ensembl ID:
ENSDARG00000068210
ZFIN ID:
ZDB-GENE-030131-5517
Description:
HAUS augmin-like complex subunit 6 [Source:UniProtKB/Swiss-Prot;Acc:A0JMF7]
Human Orthologue:
HAUS6
Human Description:
HAUS augmin-like complex, subunit 6 [Source:HGNC Symbol;Acc:25948]
Mouse Orthologue:
Haus6
Mouse Description:
HAUS augmin-like complex, subunit 6 Gene [Source:MGI Symbol;Acc:MGI:1923389]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41065 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34221 Nonsense Mutation detected in F1 DNA During 2017
sa21120 Nonsense Available for shipment Available now
sa5451 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa41065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098503 Essential Splice Site 39 794 1 16
ENSDART00000133410   None 289 None 7

The following transcripts of ENSDARG00000068210 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 65681040)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58862780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGATAACGTTTCCGTCACCAAAACAACGAAACATCTGAATCTGGGAATG[T/G]AAGTCTTATCTTTATTTTCTTCACATCCGAATAGCTTCTATGTTAGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098503 Nonsense 48 794 2 16
ENSDART00000133410   None 289 None 7

The following transcripts of ENSDARG00000068210 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 65680278)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58862018
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATGTTATTATATTTTTTTATAGGAACATGTTTGACAAACCAAACAAA[G/T]AGGCATTCTACATTGTCATTCACTTTTTATTTAATAAACTGAATCCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098503 Nonsense 378 794 10 16
ENSDART00000133410 Nonsense 40 289 1 7

The following transcripts of ENSDARG00000068210 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 65674903)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58856643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATCAAGGTTTCCATTGGGAAGCTAGAGGAAGAATGGGAGTGCAAGTG[G/A]GCAAACTGTTTGAAAAATACACCCCTCACGTGTTTTCTTGAAGAGGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5451
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098503 Essential Splice Site 580 794 15 16
ENSDART00000133410 Essential Splice Site 242 289 6 7

The following transcripts of ENSDARG00000068210 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 65673202)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58854942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCCCTTTTCATCTAGGAAACAACTTTGCCGCACTCCTGAGAGTCTAAG[T/A]ATGTGTTTGGTAGCCTAAACAWGTAGTATTCTCTACTTTATTAGAAATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link