NP_001007396.1

Ensembl ID:
ENSDARG00000068208
Description:
differentially expressed in FDCP 8 homolog [Source:RefSeq peptide;Acc:NP_001007396]
Human Orthologue:
DEF8
Human Description:
differentially expressed in FDCP 8 homolog (mouse) [Source:HGNC Symbol;Acc:25969]
Mouse Orthologue:
Def8
Mouse Description:
differentially expressed in FDCP 8 Gene [Source:MGI Symbol;Acc:MGI:1346331]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36678 Nonsense Available for shipment Available now
sa10611 Essential Splice Site Available for shipment Available now
sa43130 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098504 Nonsense 47 218 1 6
ENSDART00000139665 Nonsense 47 193 1 4
Genomic Location (Zv9):
Chromosome 18 (position 31274007)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31424138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACAAAAAGATGCAGTGGTCAAGCTTATCCACCTTCGACTTAAACTA[C/T]AAGAACTACAGGTTTGTATGATCAGTCAAAATTGCAGAACATAATTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098504 Essential Splice Site 153 218 3 6
ENSDART00000139665 Essential Splice Site 153 193 3 4
Genomic Location (Zv9):
Chromosome 18 (position 31265659)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31432486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAACAAGACTACAGATGTTCTGAATGCCGGACACCCATTTCATTGCG[T/A]GAGTCTTTTTGTATATGTAYAAAAGGTTCTTTTGCTTGGTTAATGAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098504 Nonsense 210 218 6 6
ENSDART00000139665   None 193 None 4
Genomic Location (Zv9):
Chromosome 18 (position 31265294)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31432851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAAGCAGTTTAATCCATTAAAGCACCATTTTCTGCTTCTCCAAGATT[T/A]GTTCAAAACCAACTTTTGCAAACTAGTCCTACGTTTTTTTGCCTGATCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link