si:dkey-201c13.3

Ensembl ID:
ENSDARG00000068194
ZFIN ID:
ZDB-GENE-060526-244
Description:
hypothetical protein LOC565869 [Source:RefSeq peptide;Acc:NP_001122201]
Human Orthologue:
KLF9
Human Description:
Kruppel-like factor 9 [Source:HGNC Symbol;Acc:1123]
Mouse Orthologue:
Klf9
Mouse Description:
Kruppel-like factor 9 Gene [Source:MGI Symbol;Acc:MGI:1333856]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9385 Nonsense Mutation detected in F1 DNA During 2017
sa40427 Nonsense Mutation detected in F1 DNA During 2017
sa11647 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098473 Nonsense 33 216 1 2
Genomic Location (Zv9):
Chromosome 5 (position 27720212)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25475510
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTCGAGCGCTCCGACAAACTAACCGGCGAGGAGGGGTCTGAAGAAAGT[C/T]AAGAAAGCCGGAYTCTGTTGATGGTCGCAATGATTCTGCTGGACTTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098473 Nonsense 48 216 1 2
Genomic Location (Zv9):
Chromosome 5 (position 27720258)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25475556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCAAGAAAGCCGGACTCTGTTGATGGTCGCAATGATTCTGCTGGACT[T/G]AAACCAGTGCATACCGAGCGGCATCAGCGCCAAGCGAATAGTGGACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098473 Nonsense 103 216 1 2
Genomic Location (Zv9):
Chromosome 5 (position 27720424)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25475722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAKCGCGACCGACTGCACGCATCCGCGGAGAAAAGACACTGCTGCCCGTA[T/A]GCAGGCTGTGGTAAAATATACGGCAAGTCTTCCCATCTGAAGGCGCACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Common variants at CDKAL1 and KLF9 are associated with body mass index in east Asian populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link