cdh15

Ensembl ID:
ENSDARG00000068191
ZFIN ID:
ZDB-GENE-030131-780
Description:
cadherin-15 [Source:RefSeq peptide;Acc:NP_997771]
Human Orthologue:
CDH15
Human Description:
cadherin 15, type 1, M-cadherin (myotubule) [Source:HGNC Symbol;Acc:1754]
Mouse Orthologue:
Cdh15
Mouse Description:
cadherin 15 Gene [Source:MGI Symbol;Acc:MGI:106672]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11460 Nonsense Available for shipment Available now
sa695 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa11460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098453 Nonsense 108 792 3 14
ENSDART00000127046 Nonsense 108 808 3 17
Genomic Location:
Chromosome 7 (position 57394370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAAATCGATRMWAAAACAGGATGGATYAAGAGCAAAGAGCCGCTGGAC[A/T]GAGAAAAACACAAGAGTTTTAAAGTAAGCATGTTTAGGCCAAGTACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa695
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098453 Essential Splice Site 661 792 12 14
ENSDART00000127046 Essential Splice Site 659 808 14 17
Genomic Location:
Chromosome 7 (position 57404189)
KASP Assay ID:
554-0603.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACAACGTCTTTCATTATGATGAGCAGGGAGGYGGAGAAGAGGATGAG[G/A]TAAGAKCATTGACACTACATTTAATAAAGCTATGGTAAAAAAATAAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2ypf7wwg